ID: 1174503562_1174503577

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1174503562 1174503577
Species Human (GRCh38) Human (GRCh38)
Location 20:51002762-51002784 20:51002807-51002829
Sequence CCCCCTCCCCACGCCTGGCACTG TGGAGTAGAATCTGCTGGACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 89, 4: 868} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!