ID: 1174516953_1174516963

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1174516953 1174516963
Species Human (GRCh38) Human (GRCh38)
Location 20:51100035-51100057 20:51100081-51100103
Sequence CCAACCCTGTACATTCCAATAGG TCCAGGGCTTCCAGGTTCTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 23, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!