ID: 1174542226_1174542230

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1174542226 1174542230
Species Human (GRCh38) Human (GRCh38)
Location 20:51298570-51298592 20:51298593-51298615
Sequence CCAGCACCAGGGCGGAGAGAGAT CTTGGTTAGTATTCCTAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 132} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!