ID: 1174553270_1174553282

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1174553270 1174553282
Species Human (GRCh38) Human (GRCh38)
Location 20:51376469-51376491 20:51376496-51376518
Sequence CCCAGCTCCATCTTTACAGAGGG GGGGCAGGAGGCATGAGGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 161, 4: 1239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!