ID: 1174614740_1174614750

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1174614740 1174614750
Species Human (GRCh38) Human (GRCh38)
Location 20:51827206-51827228 20:51827236-51827258
Sequence CCCCCGATCACAGACACTGTGGC TGGATGGGCGCTTCCATTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!