ID: 1174620022_1174620026

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1174620022 1174620026
Species Human (GRCh38) Human (GRCh38)
Location 20:51866932-51866954 20:51866983-51867005
Sequence CCAACAGGAGAACAGATGAACAA TACTCAGCAGCCGGGCACGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 14, 3: 141, 4: 948}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!