ID: 1174659539_1174659547

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1174659539 1174659547
Species Human (GRCh38) Human (GRCh38)
Location 20:52199588-52199610 20:52199632-52199654
Sequence CCTATTTTGGCCAAGTGTGGTGG TTTTGGGAGGCTGAAGCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 35, 3: 176, 4: 930} {0: 117, 1: 3367, 2: 36096, 3: 99919, 4: 181490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!