ID: 1174664640_1174664647

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1174664640 1174664647
Species Human (GRCh38) Human (GRCh38)
Location 20:52246596-52246618 20:52246642-52246664
Sequence CCATTAGGTGATTTTTCATCACA AAAAAATGGAAAGGAATGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 416} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!