ID: 1174699425_1174699428

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1174699425 1174699428
Species Human (GRCh38) Human (GRCh38)
Location 20:52592729-52592751 20:52592746-52592768
Sequence CCTATGCCAAAACCACAATTTTC ATTTTCTCCTCAAAGATCTAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!