ID: 1174702198_1174702202

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1174702198 1174702202
Species Human (GRCh38) Human (GRCh38)
Location 20:52620365-52620387 20:52620379-52620401
Sequence CCAAGGCTCTATTTCCAAATAGG CCAAATAGGGCCATATTTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 44, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!