ID: 1174770055_1174770061

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1174770055 1174770061
Species Human (GRCh38) Human (GRCh38)
Location 20:53291159-53291181 20:53291179-53291201
Sequence CCAAATACCCTGGTCAAAAATAT TATCAAGAGCAGGCTGGGAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 54, 4: 490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!