ID: 1174854270_1174854278

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1174854270 1174854278
Species Human (GRCh38) Human (GRCh38)
Location 20:54028346-54028368 20:54028392-54028414
Sequence CCGAGCATGCATTCAGAACCAAG CTTCCCTGCAGGGACATCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 170} {0: 1, 1: 0, 2: 1, 3: 16, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!