ID: 1174898677_1174898687

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1174898677 1174898687
Species Human (GRCh38) Human (GRCh38)
Location 20:54476070-54476092 20:54476105-54476127
Sequence CCAGCATCCCTGGAGGGTGGACG CCGCGCGCCGGAGAATTGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 234} {0: 1, 1: 0, 2: 0, 3: 2, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!