ID: 1174932901_1174932904

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1174932901 1174932904
Species Human (GRCh38) Human (GRCh38)
Location 20:54834838-54834860 20:54834881-54834903
Sequence CCATTTCTGGATTTTATTTTTAT CATGGTTTCCAACCATCCAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 18, 3: 287, 4: 2638} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!