ID: 1174970198_1174970202

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1174970198 1174970202
Species Human (GRCh38) Human (GRCh38)
Location 20:55266712-55266734 20:55266753-55266775
Sequence CCCAGTCAGTCCTCCACAAGACA AAGAGTTCAAAGAGATTTTCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!