ID: 1175001216_1175001225

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1175001216 1175001225
Species Human (GRCh38) Human (GRCh38)
Location 20:55632627-55632649 20:55632676-55632698
Sequence CCACTCAGCCTGGCAGGCTGTGC ATGCCTGCCACGGGCGAGACAGG
Strand - +
Off-target summary {0: 57, 1: 84, 2: 152, 3: 260, 4: 586} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!