ID: 1175001220_1175001231

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1175001220 1175001231
Species Human (GRCh38) Human (GRCh38)
Location 20:55632662-55632684 20:55632692-55632714
Sequence CCGGTCTCAATCCCATGCCTGCC AGACAGGTGTGGAGTGGCAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 33, 3: 108, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!