ID: 1175001224_1175001234

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1175001224 1175001234
Species Human (GRCh38) Human (GRCh38)
Location 20:55632674-55632696 20:55632712-55632734
Sequence CCATGCCTGCCACGGGCGAGACA GGGGTGTGTGAGCAAGTGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 128, 4: 245} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!