ID: 1175001638_1175001643

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1175001638 1175001643
Species Human (GRCh38) Human (GRCh38)
Location 20:55635513-55635535 20:55635548-55635570
Sequence CCCTCCAGTTTCTGTTTGTTTGT ACATTGAGATACAGAAGACAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 25, 3: 163, 4: 1496} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!