ID: 1175036281_1175036293

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1175036281 1175036293
Species Human (GRCh38) Human (GRCh38)
Location 20:56004228-56004250 20:56004276-56004298
Sequence CCTACCCCGGGATCCCGGTGCTC CAGCGCTGCAGGAGCGACGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 148} {0: 1, 1: 0, 2: 2, 3: 7, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!