ID: 1175057787_1175057794

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1175057787 1175057794
Species Human (GRCh38) Human (GRCh38)
Location 20:56213930-56213952 20:56213956-56213978
Sequence CCCCTCTGGTCCCACAAAATCAT GATGCCTCTTAACCCTGCGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!