ID: 1175060345_1175060349

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1175060345 1175060349
Species Human (GRCh38) Human (GRCh38)
Location 20:56236458-56236480 20:56236492-56236514
Sequence CCCATGCTATTCTCGTGATAGTG CAAGATCTGATGGGCTTATTAGG
Strand - +
Off-target summary No data {0: 1, 1: 26, 2: 273, 3: 1633, 4: 3215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!