ID: 1175108332_1175108342

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1175108332 1175108342
Species Human (GRCh38) Human (GRCh38)
Location 20:56629638-56629660 20:56629670-56629692
Sequence CCGGGAGGCAGGGGCCACTGGAC GGACGAGGGCATAGGAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 431} {0: 1, 1: 0, 2: 0, 3: 13, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!