ID: 1175133828_1175133846

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1175133828 1175133846
Species Human (GRCh38) Human (GRCh38)
Location 20:56808508-56808530 20:56808553-56808575
Sequence CCCACCCATGGCTGGGGGCCTGT GGTGCTGTTTCCGGGTTTCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!