ID: 1175147460_1175147468

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1175147460 1175147468
Species Human (GRCh38) Human (GRCh38)
Location 20:56907690-56907712 20:56907723-56907745
Sequence CCCTGATCCACCAGTCAAAATGA CCTTTTCCTCTGAACTCCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 30, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!