ID: 1175166870_1175166875

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1175166870 1175166875
Species Human (GRCh38) Human (GRCh38)
Location 20:57050182-57050204 20:57050208-57050230
Sequence CCTCTGGGAGCCTCGGTTTCTCC TGCAAAACAGGCATGATAATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 20, 3: 177, 4: 1258} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!