ID: 1175214212_1175214215

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1175214212 1175214215
Species Human (GRCh38) Human (GRCh38)
Location 20:57382216-57382238 20:57382242-57382264
Sequence CCCTGATTTTTCTGTTTCAAACT TGTCCGCGATGGTTTCCTCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 0, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!