ID: 1175215896_1175215905

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1175215896 1175215905
Species Human (GRCh38) Human (GRCh38)
Location 20:57391578-57391600 20:57391607-57391629
Sequence CCCCATGCTGCTGCAGCCCGCGC CCCCGAGCGCGGGCTTCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 222} {0: 1, 1: 0, 2: 1, 3: 13, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!