ID: 1175219525_1175219544

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1175219525 1175219544
Species Human (GRCh38) Human (GRCh38)
Location 20:57408983-57409005 20:57409032-57409054
Sequence CCTCTACCCCCGCACCACCTGCT CTGTCTTGGGGGTTGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 547} {0: 1, 1: 2, 2: 6, 3: 57, 4: 510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!