ID: 1175228605_1175228617

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1175228605 1175228617
Species Human (GRCh38) Human (GRCh38)
Location 20:57459814-57459836 20:57459859-57459881
Sequence CCAAGACTGGGAAGGGAAGGGGA CCTGGGGAGACCGTTTCCCTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!