ID: 1175262345_1175262347

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1175262345 1175262347
Species Human (GRCh38) Human (GRCh38)
Location 20:57682458-57682480 20:57682471-57682493
Sequence CCTGGAGTGTCGGGGTCCTAGGC GGTCCTAGGCGCCGGCCCAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!