ID: 1175349805_1175349818

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1175349805 1175349818
Species Human (GRCh38) Human (GRCh38)
Location 20:58309766-58309788 20:58309802-58309824
Sequence CCGCGGCGGCGTCCCGGCTGCTA GCGGCTGGCAGCGGACAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78} {0: 1, 1: 0, 2: 0, 3: 16, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!