ID: 1175349814_1175349828

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1175349814 1175349828
Species Human (GRCh38) Human (GRCh38)
Location 20:58309796-58309818 20:58309842-58309864
Sequence CCCCACGCGGCTGGCAGCGGACA GGGCGGCAGCCGCCTCTGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 58} {0: 1, 1: 1, 2: 2, 3: 63, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!