ID: 1175366806_1175366829

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1175366806 1175366829
Species Human (GRCh38) Human (GRCh38)
Location 20:58461432-58461454 20:58461475-58461497
Sequence CCCCGAGCTGACCCACCAGCCGC AGAGGGGGCGGCAGCACGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 130} {0: 1, 1: 0, 2: 2, 3: 41, 4: 993}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!