ID: 1175378104_1175378118

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1175378104 1175378118
Species Human (GRCh38) Human (GRCh38)
Location 20:58543101-58543123 20:58543150-58543172
Sequence CCACCGGATCCCTGCAGATGGCT GGAGCGGGCCCCCAGCCCCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 25, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!