ID: 1175380966_1175380970

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1175380966 1175380970
Species Human (GRCh38) Human (GRCh38)
Location 20:58563941-58563963 20:58563989-58564011
Sequence CCACTATGCTTGCCAGAATGGCT AGTGTTGACGAGGATGTGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 10, 3: 35, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!