ID: 1175386766_1175386769

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1175386766 1175386769
Species Human (GRCh38) Human (GRCh38)
Location 20:58601343-58601365 20:58601384-58601406
Sequence CCAGCAGCGCAGGAGGGCTCTAA GAGCCGATGCTTGTTGCCATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!