ID: 1175399529_1175399545

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1175399529 1175399545
Species Human (GRCh38) Human (GRCh38)
Location 20:58692728-58692750 20:58692767-58692789
Sequence CCCGGGCGGGCCCTGCACGTCTC GGCGGGGGAGGCGGGGCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 169} {0: 1, 1: 2, 2: 38, 3: 286, 4: 2065}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!