ID: 1175412098_1175412105

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1175412098 1175412105
Species Human (GRCh38) Human (GRCh38)
Location 20:58777174-58777196 20:58777217-58777239
Sequence CCACCAGGTGTACTTGGTGGAGA GCAGAAAGAACTCAGGCTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 38, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!