ID: 1175413421_1175413439

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1175413421 1175413439
Species Human (GRCh38) Human (GRCh38)
Location 20:58786115-58786137 20:58786166-58786188
Sequence CCCCCCCCCCCCCCGGGGACATT TTGTTGATTACTAGGGATGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 17, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!