ID: 1175413430_1175413439

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1175413430 1175413439
Species Human (GRCh38) Human (GRCh38)
Location 20:58786123-58786145 20:58786166-58786188
Sequence CCCCCCGGGGACATTTGGCAAGT TTGTTGATTACTAGGGATGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 185, 4: 615} {0: 1, 1: 0, 2: 0, 3: 17, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!