ID: 1175416876_1175416888

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1175416876 1175416888
Species Human (GRCh38) Human (GRCh38)
Location 20:58807329-58807351 20:58807374-58807396
Sequence CCTCGGCCTCCCAAAGTGCTGGG CCCGGCCCCATGTTGTTATTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 6, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!