ID: 1175417613_1175417620

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1175417613 1175417620
Species Human (GRCh38) Human (GRCh38)
Location 20:58812030-58812052 20:58812070-58812092
Sequence CCACCTTCCAGGCTGCTTAGACC GCCCTCGGTCACCTCCTCCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!