ID: 1175419570_1175419578

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1175419570 1175419578
Species Human (GRCh38) Human (GRCh38)
Location 20:58822876-58822898 20:58822892-58822914
Sequence CCCTACGTGTTCCCGACCTAGGG CCTAGGGCTGGGCTCTGACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 36, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!