ID: 1175424058_1175424065

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1175424058 1175424065
Species Human (GRCh38) Human (GRCh38)
Location 20:58853341-58853363 20:58853362-58853384
Sequence CCCGAGCAACCACCTTTGGAGGC GCCCCAGGGGCAGCTGCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 97} {0: 1, 1: 1, 2: 7, 3: 70, 4: 597}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!