ID: 1175424059_1175424070

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1175424059 1175424070
Species Human (GRCh38) Human (GRCh38)
Location 20:58853342-58853364 20:58853369-58853391
Sequence CCGAGCAACCACCTTTGGAGGCC GGGCAGCTGCCCCCGGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 156} {0: 1, 1: 0, 2: 1, 3: 28, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!