ID: 1175424063_1175424069

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1175424063 1175424069
Species Human (GRCh38) Human (GRCh38)
Location 20:58853350-58853372 20:58853368-58853390
Sequence CCACCTTTGGAGGCCCCAGGGGC GGGGCAGCTGCCCCCGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 46, 4: 333} {0: 1, 1: 0, 2: 0, 3: 48, 4: 358}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!