ID: 1175433715_1175433723

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1175433715 1175433723
Species Human (GRCh38) Human (GRCh38)
Location 20:58927650-58927672 20:58927678-58927700
Sequence CCACCTAACCCCATATGGCAGGG CCATTCTAGCATGTGGCAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!