ID: 1175460145_1175460152

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1175460145 1175460152
Species Human (GRCh38) Human (GRCh38)
Location 20:59146301-59146323 20:59146337-59146359
Sequence CCTGCCTCATCGGAGCCACCGGT CGGCAGCCCCCACCTGCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60} {0: 1, 1: 1, 2: 0, 3: 42, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!