ID: 1175487580_1175487588

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1175487580 1175487588
Species Human (GRCh38) Human (GRCh38)
Location 20:59356484-59356506 20:59356517-59356539
Sequence CCTCCAGCAGATCCTTCAGAAGG GCTGTCACTGGGCCTTCCCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 38, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!